Tài liệu Báo cáo khoa học: Post-translational cleavage of recombinantly expressed nitrilase from Rhodococcus rhodochrous J1 yields a stable, active helical form ppt

Tài liệu Báo cáo khoa học: Post-translational cleavage of recombinantly expressed nitrilase from Rhodococcus rhodochrous J1 yields a stable, active helical form ppt

Tài liệu Báo cáo khoa học: Post-translational cleavage of recombinantly expressed nitrilase from Rhodococcus rhodochrous J1 yields a stable, active helical form ppt

... FEBS Post-translational cleavage of recombinantly expressed nitrilase from Rhodococcus rhodochrous J1 yields a stable, active helical form R. Ndoria Thuku 1,2 , Brandon W. Weber 2 , Arvind Varsani 2 and B. ... specific post-translational cleavage of recombinantly expressed nitrilase from R. rhodochrous J1 which leads to the for- mation of st...
Ngày tải lên : 19/02/2014, 00:20
  • 10
  • 450
  • 0
Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc

Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc

... substrate-free AppA the C a atoms are 2.41 A ˚ apart, whereas for the substrate-free PhyK and the substrate-loaded AppA the averaged distance is only 1.87 A ˚ . Distinct conformational changes ... phytate with pH optima in the acidic range. They consist of two domains, a large a ⁄ b domain and a small a domain with the catalytic site at the interface of the two domains [4,5]...
Ngày tải lên : 16/02/2014, 09:20
  • 13
  • 766
  • 0
Tài liệu Báo cáo khoa học: Enhanced thermostability of methyl parathion hydrolase from Ochrobactrum sp. M231 by rational engineering of a glycine to proline mutation pdf

Tài liệu Báo cáo khoa học: Enhanced thermostability of methyl parathion hydrolase from Ochrobactrum sp. M231 by rational engineering of a glycine to proline mutation pdf

... MPH a Forward: 5¢-TAGAATTCGCTGCTCCACAA GTTAGAACT-3¢ Reverse: 5¢-TA GCGGCCGCTTACTTTGGGTTA ACGACGGA-3¢ Mutant MPH b G194P 5¢-CCTGACGATTCTAAACCGTTCTTCAAGGGTGCC-3¢ G198P 5¢-AAAGGTTTCTTCAAG CCGGCCATGGCTTCCCTT-3¢ G194P ... Gribenko AV, Patel MM, Liu J, McCallum SA, Wang C & Makhatadze GI (2009) Rational stabilization of enzymes by computational redesign of surface charge- charge interacti...
Ngày tải lên : 15/02/2014, 01:20
  • 8
  • 740
  • 0
Tài liệu Báo cáo khoa học: Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress docx

Tài liệu Báo cáo khoa học: Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress docx

... AATGCTGGCTCTCCCTCGAT GCTTGGCTACTGGACCATCAA HYPK GGAAATGGAAATAACAAGACAAATAGC GCGCAACTAATGCTTCCACAA HSP70 TGACCAAGGCAACAGAACCA AATCAGACGGCCGGTATGTG Heat shock 70 kDa protein 1 2A CGAAAAAGGACAGCAGTTGAAA CTCATCCTCCACCGGATTGT HSP23 CGTCCGATTTCTTCTCGTGTTT ACCAGAAGACATTACAGTGAAAATTGA Chaperonin-containing ... kinase complex-associated protein AAAGCAGAGCAGAAAAAGTGGAA GGACAATGCCGCGATCAG Non-selenium...
Ngày tải lên : 18/02/2014, 16:20
  • 11
  • 570
  • 0
Tài liệu Báo cáo khoa học: "Automatic Construction of Polarity-tagged Corpus from HTML Documents" docx

Tài liệu Báo cáo khoa học: "Automatic Construction of Polarity-tagged Corpus from HTML Documents" docx

... result. Classifier and data sets As a classifier, we chose Naive Bayes with bag -of- words features, because it is one of the most popular one in this task. Negation was processed in a similar way as previous ... works (Pang et al., 2002). To validate the accuracy of the classifier, three data sets were created from review pages in which the review is associated with meta-data. To buil...
Ngày tải lên : 20/02/2014, 12:20
  • 8
  • 409
  • 0
Tài liệu Báo cáo khoa học: The role of the SEA (sea urchin sperm protein, enterokinase and agrin) module in cleavage of membrane-tethered mucins pdf

Tài liệu Báo cáo khoa học: The role of the SEA (sea urchin sperm protein, enterokinase and agrin) module in cleavage of membrane-tethered mucins pdf

... reactive non- cleaved glycoform of about 105–120 kDa (Fig. 4A, C, MUC3SEA and MUC12SEA) and a minor population of a CT-2 reactive, M2 nonreactive cleavage product, at about 25 kDa for MUC3 and ... 5¢-GTTCAGGCCAGGAGCTGTGGTG GTACAATTG-3¢ (sense), 5¢-CAATTGTACCACCACAG CTCCTGGCCTGAAC-3¢ (antisense), R ⁄ A substitution: SEA modules and mucin cleavage T. Palmai-Pallag et al. 2908 FEBS...
Ngày tải lên : 19/02/2014, 18:20
  • 11
  • 605
  • 0
Tài liệu Báo cáo khoa học: Molecular basis of glyphosate resistance – different approaches through protein engineering doc

Tài liệu Báo cáo khoa học: Molecular basis of glyphosate resistance – different approaches through protein engineering doc

... lyase pathway). Bottom: cleavage to yield AMPA and glyoxylate (the AMPA pathway), referred to as the GOX pathway. (B) Reaction catalyzed by GO on glyphosate, an alternative to the AMPA pathway ... different from that of GOX. Oxidases GOX (Monsanto) Early on, Monsanto Co. isolated glyphosate-AMPA bacteria from a glyphosate waste stream treatment facility. Achromobacter sp. LBAA was t...
Ngày tải lên : 14/02/2014, 14:20
  • 14
  • 793
  • 0
Tài liệu Báo cáo khoa học:Tyrosine phosphorylation of tau regulates its interactions with Fyn SH2 domains, but not SH3 domains, altering the cellular localization of tau ppt

Tài liệu Báo cáo khoa học:Tyrosine phosphorylation of tau regulates its interactions with Fyn SH2 domains, but not SH3 domains, altering the cellular localization of tau ppt

... blotting of lysates from pervanadate-treated cells with an antibody against total tau revealed decreased electrophoretic mobility of tau, with the appearance of an  68-kDa tau species in wild-type and all ... Pervandate and catalase were prepared as described previously [25]. Briefly, vanadate stock solution was prepared as a 200 m M solution of sodium orthovanadate (pH 10). Perva...
Ngày tải lên : 14/02/2014, 14:20
  • 11
  • 628
  • 0
Tài liệu Báo cáo khoa học: Crystal structure of an ascomycete fungal laccase from Thielavia arenaria – common structural features of asco-laccases ppt

Tài liệu Báo cáo khoa học: Crystal structure of an ascomycete fungal laccase from Thielavia arenaria – common structural features of asco-laccases ppt

... ascomycete fungal laccase from Thielavia arenaria – common structural features of asco-laccases Juha P. Kallio 1 , Chiara Gasparetti 2 , Martina Andberg 2 , Harry Boer 2 , Anu Koivula 2 , Kristiina Kruus 2 , Juha ... observed for MaL, that may determine the properties of these asco-laccases at high protein concentrations. Database Structural data are available in the Protein Data Bank d...
Ngày tải lên : 14/02/2014, 18:20
  • 13
  • 888
  • 0
Tài liệu Báo cáo khoa học: Crystal structure of importin-a bound to a peptide bearing the nuclear localisation signal from chloride intracellular channel protein 4 ppt

Tài liệu Báo cáo khoa học: Crystal structure of importin-a bound to a peptide bearing the nuclear localisation signal from chloride intracellular channel protein 4 ppt

... importin -a nuclear import pathway, provided that CLIC4 can undergo a conforma- tional rearrangement that exposes the NLS in an extended conformation. Database Structural data are available in ... atoms) and r j is the standard deviation of B factors. The normalized B factors have a zero mean and unit variance. All atoms that satisfy B z ‡ 4 are treated as outliers and discarded. After...
Ngày tải lên : 14/02/2014, 19:20
  • 14
  • 741
  • 0

Xem thêm

Từ khóa: