Tài liệu Báo cáo khoa học: Structural insights into the substrate specificity and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria ppt
Tài liệu Báo cáo khoa học: Structural insights into the substrate specificity and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria ppt
... proteases from a tropical plant, Ervatamia coronaria Raka Ghosh, Sibani Chakraborty, Chandana Chakrabarti, Jiban Kanti Dattagupta and Sampa BiswasCrystallography and Molecular Biology Division, Saha Institute ... S, Sundd M, Jagan-nadham MV & Dattagupta JK (1999) Crystallization and preliminary X-ray analysis of ervatamin B and C,two thiol proteases from Ervatamia coronaria. ActaCrystallogr D 55, ... Biswas S, Chakrabarti C, Sundd M,Jagannadham MV & Dattagupta JK (2004) Structural basis of the unusual stability and substrate specificity of ervatamin C, a plant cysteine protease from Ervata-mia...
- 14
- 634
- 0
Tài liệu Báo cáo khóa học: Further insights into the assembly of the yeast cytochrome bc1 complex based on analysis of single and double deletion mutants lacking supernumerary subunits and cytochrome b pdf
... c1 and a disappearance of the intermediate form of the Rieske protein. At the same time, the levels of subunits 7, 8 and 9 significantly decreased in this mutantstrain. However, the amounts of ... around the catalytic core of the enzyme to arrive at the three dimen-sional organization revealed by the crystal structures(Fig. 1A) . The supernumerary subunits and the catalyticsubunits of ... of membranes in which the catalytic and structural core of the enzyme is absent.Experimental proceduresMaterialsYeast extract and bacto-peptone were purchased from Difco. Yeast nitrogen base...
- 10
- 517
- 0
Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): reactivity and structure of metal–thiolate clusters* doc
... are characterized by a conserved array of 20 cysteines and the absence of His and aromatic amino acids. MT3 contains 68amino acids with 70% sequence identity to the MT1 and MT2 (MT1 ⁄ 2) isoforms. ... kinetically labile, allowing rapid intra-molecular and intermolecular metal transfer. This is a direct consequence of the relatively high structural dynamics and flexibility typical of all MTs ... just the result of the larger ionic radius of Cd(II)over Zn(II) and that the difference in amino acidsequence plays a role.One of the most important aspects is the greaterdynamics of the Cd(II)3-CysS9cluster...
- 10
- 569
- 0
Tài liệu Báo cáo khoa học: Poly(silicate)-metabolizing silicatein in siliceous spicules and silicasomes of demosponges comprises dual enzymatic activities (silica polymerase and silica esterase) doc
... biomaterials based on layeredsilica, of titania and of zirconia [32]. This view is basedon the finding of a dual role for silicatein as an ana-bolic (silica polymerase) and catabolic enzyme (silicaesterase), ... a Finnigan MAT mass spectrometer 8230 (Midland; Canada).In a control assay, the reaction was performed in the absence of silicatein.Esterase activity The assay is based on the concentration-dependentincrease ... [33,34]; the fractal pat-tern probably dictates the initial shape of the spicules[34]. The finding that silicatein catalyzes two reactions,acting as silica polymerase and silica esterase, providesthis...
- 9
- 576
- 0
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx
... catalyticefficiency and substrate specificity of PRTFDC1 wasfurther characterized using a radiochemical assay withtritium-labeled bases as substrates, whereas the struc-tural basis for substrate recognition and ... phosphoribosyl-transferase activity [10]. The structural characterization of numerous com-plexes of the human HPRT and several bacterial and protozoan HPRTs have been undertaken [13–17]. The structure of ... 6615–6627.24 Raman J, Sumathy K, Anand RP & Balaram H (2004) A non-active site mutation in human hypoxanthineguanine phosphoribosyltransferase expands substrate specificity. Arch Biochem Biophys...
- 11
- 770
- 0
Tài liệu Báo cáo khoa học: Structural features of proinsulin C-peptide oligomeric and amyloid states pptx
... The observation that self-asso-ciating peptides and proteins are at the core of severalneurodegenerative diseases has led to a massive effortaiming to understand the physiologically relevantstructures ... collected and aver-aged for each experiment.ATR-IR spectroscopyAliquots of samples were taken from each of the samplesused for CD spectroscopy and dried over the ATR dia-mond surface of a Bruker ... Reid GE, Karunarathne WK& Spence DM (2008) Metal-activated C-peptide facili-tates glucose clearance and the release of a nitric oxidestimulus via the GLUT1 transporter. Diabetologia 51,175–182.28...
- 10
- 561
- 0
Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: electron transfer through the nitric oxide synthase flavoprotein domain pdf
... has fundamen-tal structural, thermodynamic and mechanistic featuresin common with the dual-flavin family of reductases,there are unique aspects related to NO synthesis thatconstrain and shape ... suggestthat Keq A and the associated kon and koffconforma-tional rates are primary factors in regulating the cyto-chrome c reductase activity of NOS enzymes,particularly in the CaM-free state.Do ... [61,71–76].Is there a correlation between NOSreductase activity and Keq A? That a relationship exists between the Keq A and the cytochrome c reductase activity of the CaM-free reduc-tase domain of neuronal...
- 16
- 639
- 0
Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: probes of hydrogen tunnelling pptx
... (wt) and N18 9A mutant of MR withNADH. The wt trace is fit to a single exponential and the N18 9A trace to a 4-exponential function – see the main text for moredetails. (Inset) The same data on a ... 2009)doi:10.1111/j.1742-4658.2009.07121.xAt least half of all enzyme-catalysed reactions are thought to involve a hydrogen transfer. In the last 10 years, it has become apparent that many of these reactions will occur, in part, ... kJÆmol)1[9]. From the little experimental evidence cur-rently available, it appears that it is appropriate todescribe H-tunnelling reactions using Marcus theory, and that a general feature of these reactions...
- 12
- 595
- 0
Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: photosynthetic electron transfer from photosystem I to NADP+ doc
... coordinatedby cysteines located in both of the large PSI subunits,PsaA and PsaB, via a loop that also plays a role in the attachment of PsaC [12]. PsaC, PsaD and PsaE arelocated at the cytosolic ... plastids, mitochondria and bacteria.They are also the basic prototypes for a large family of diflavin electrontransferases with common functional and structural properties. Under-standing their ... in favour of a stronger H-bond between the carbonyl of N58 (‘O-up’ conformation) and FMNN(5)H [41]. The semiquinone states of A. nidulans and Anabaena Flds are less stable than those from otherspecies...
- 17
- 634
- 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... siteW11F WT W11F CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoIW168F WT W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIWT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIY74W* WT* W11F ... effects of a dimer interface mutation oncatalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutationsMousumi Banerjee1, Hemalatha Balaram2 and Padmanabhan ... Structure and function of a regulated archaealtriosephosphate isomerase adapted to high temperature.J Mol Biol 342, 861–875.12 Gayathri P, Banerjee M, Vijayalakshmi A, Azeez S,Balaram H, Balaram...
- 15
- 635
- 0
Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdftài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học công nghệ phục vụ nông nghiệp và phát triển nông thôn các tỉnh phía bắc 2006 2007 tài liệu phục vụ hội nghịbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vientai lieu bao cao thuc tap y si da khoabáo cáo khoa học ảnh hưởng của tuổi thu hoạch đến năng suất và chất lượng thức ăn của cỏ voi pennisetum purpureum cỏ ghi nê panicum maximum trồng tại đan phượng hà tây pptxtai lieu bao cao thuc tap tim hieu nhan cach mot hoc sinhbáo cáo khoa học về nghệ thuật trong lieu trai chi ditai lieu bao cao thuc tap tai khoa duoc benh vien hop lucđề tài báo cáo khoa họcđề tài báo cáo khoa học sinh họcBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM