... and appears to be much more
resistant to proteasomal degradation than Rac1L61. Mutational analysis of
all lysine residues in Rac1 revealed that the major target site for Rac1
ubiquitination is ... Indeed, in Rac2 and Rac3, which
are resistant to proteasomal degradation, Lys1 47 is
either absent (Rac3), or is in a different environment as
compared to Rac1 (Rac2). Lys1 47 is not...
... Schapira AH (2008) Mitochondria in the aetiology and
pathogenesis of Parkinson’s disease. Lancet Neurol 7,
97–109.
4 Hayashi S, Wakabayashi K, Ishikawa A, Nagai H, Sai-
to M, Maruyama M, Takahashi ... stress conditions. Specifically, this association is
mediated by pathogenic DJ-1 mutations and oxidative
stress [76]. These data suggest a link DJ-1 and Parkin in
a common pathway in mam...
... cleavage via
the mitochondrial pathway [47]. Caspase-9 is also
cleaved by caspase-3 at another cleavage site. How-
ever, this fragmentation does not have caspase activity.
It enhances the activation ... 28549–28552.
53 Sakahira H, Enari M & Nagata S (1998) Cleavage of
CAD inhibitor in CAD activation and DNA degrada-
tion during apoptosis. Nature 391, 96–99.
54 Agarwal A, Mahfouz...
... MPH
a
Forward: 5¢-TAGAATTCGCTGCTCCACAA
GTTAGAACT-3¢
Reverse: 5¢-TA
GCGGCCGCTTACTTTGGGTTA
ACGACGGA-3¢
Mutant MPH
b
G194P 5¢-CCTGACGATTCTAAACCGTTCTTCAAGGGTGCC-3¢
G198P 5¢-AAAGGTTTCTTCAAG
CCGGCCATGGCTTCCCTT-3¢
G194P ... can adopt only a few configurations and has the
lowest conformational entropy [19,20]. A glycine to
proline mutation could therefore decrease the confor-
mational entrop...
... that upon peptide binding, NarJ
undergoes a conformational change. Isothermal titra-
tion calorimetry (ITC) and BIAcore analysis showed
that protonation of the chaperone is responsible for
a ... mostly via hydrophobic interactions as deduced from
isothermal titration calorimetry analysis. NMR and differential scanning
calorimetry analysis revealed a modification of NarJ conformation...
... inhibit a linked
activation domain, and this inhibition is not limited to the Meis2 activation
domain. Database searching reveals that the Meis3.2 splice variant, which
is found in several vertebrate ... suggesting that the
approximately 150 amino acids C-terminal to the HD
of Meis2d contain a transcriptional AD.
Both the Meis2 AD and the Hth domain are
required for tra...
... is the restriction of motion along
the acyl chains once the lipids have packed around
the protein. Because this behavior arises as a result of
the tilt of the peptide and interactions between the
embedded ... neuritic
plaques observed in the brains of Alzheimer’s patients.
Because Ab is localized in the plasma membrane,
an analysis of the interactions between the p...
... maturation but at the same time
an unaltered conformational distribution of the N-ter-
minal tail and a normal response to TF.
Discussion
FVIIa contains the canonical activation domain char-
acteristic ... supporting the
active conformation. One bond participates in stabil-
ization of the 170 loop while the other connects activa-
tion loops 2 and 3. Weakening or abrogation of...
... [4–7].
The major drawback of these analyses is the lack of
information regarding the activity or loss of activity
of the target protein, as only a few variants (< 100)
have been fully analysed. ... there
is 75% probability for the mutation to be nonsevere if
the energy is 0.125 or lower. Thus, on the basis of this
variable alone, we can make reasonably accurate pre-...