Tài liệu Báo cáo khoa học: Mouse recombinant protein C variants with enhanced membrane afﬁnity and hyper-anticoagulant activity in mouse plasma pptx

... Morphological-Biomedical Sciences, University Hospital of Verona, ItalyIntroduction Protein C is a vitamin K-dependent c- carboxyglutamicacid-containing protein (Gla protein) found in human and mouse plasma ... recombinant protein C preparations weredetermined by SDS-PAGE followed by silver staining.Preparation of mouse activated protein C Incubation of mouse protein C with human or bovinethrombin ... anticoagulant activity. AbbreviationsAPC, activated protein C; C max, maximal concentration of thrombin; ETP, endogenous thrombin potential; Gla protein, c- carboxyglutamicacid-containing protein; DOPS,...

Tài liệu Báo cáo khóa học: A multi-protein complex containing cold shock domain (Y-box) and polypyrimidine tract binding proteins forms on the vascular endothelial growth factor mRNA Potential role in mRNA stabilization pptx

... 3B).To investigate the individual roles CSD and PTB proteinsmay play in directing CCV1 complex binding to the5¢-ACCUCUU-3¢ and 5¢-UUUUCUU-3¢ sequences, recombinant CSD (GST-dbpB/YB-1) and PTB ... probes are derived from pGEM44 and pGEMV1, respectively. Cytoplasmic complexes CC44a and CCV1 and unbound RNA probe are indicated. (C) Cytoplasmic complexesCC44 and CCV1, in gel shift assay gels, ... required for cytoplasmic complex(CCVC1) formation, with recombinant PTB primarilycontacting the downstream PTB site and CSD protein contacting both sites.TheVEGFmRNA CSD/PTB binding sites play...

Tài liệu Báo cáo khoa học: Regulation of connective tissue growth factor (CTGF/CCN2) gene transcription and mRNA stability in smooth muscle cells Involvement of RhoA GTPase and p38 MAP kinase and sensitivity to actin dynamics docx

... monomericG-actin i s a critical determinant for CTGF/CCN2 geneinduction. These data indicate that distinct cytoskeletallybased signaling events within the intracellular signalingmachinery aﬀect ... G-actininhibited CTGF/CC N2 gene induction, whereas F-actin enhanced CTGF/CCN2 gene express ion. F ourth, a ctinmonomer-sequestering agents that mimic the physiologicG-actin-binding proteins induced the ... oenhance the expression of the endogenous CTGF/CCN2gene. As shown in Fig. 3C, transfection of the cells with CA-RhoA and C A-Cdc42 induced a 215 and 1 75% increase in CTGF/CCN2 mRNA levels, respectively...

Tài liệu Báo cáo khoa học: Transient RNA–protein interactions in RNA folding docx

... the protein can bind tothe RNA molecule when it has already adopted itscorrect structure, or the speci c binder can interact with the RNA during its folding process and can accel-erate folding ... [50,57–59] hint at theinteraction between the proteins’ basic amino acids and the nucleic acid backbone via ionic forces. In fact,transient interactions are characterized mainly bylong-range electrostatic ... proteins,which recognize and bind certain RNAs and thusstabilize the RNA structure, thereby forming a stableRNA -protein complex; (b) proteins with RNA chaper-one and annealing activity, which interact only...

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

... artiﬁcial substrate myelinbasic protein (MBP) but not GST (Fig. 4A). Althoughno kinase activity could be detected for PTI1-4 in vitro,incubating OXI1 with increasing amounts of PTI1-4 enhanced ... then examined how both proteinsinteract with MPK3 and MPK6 proteins.ResultsAGC kinases interact with PTI1 kinases in vitroTo isolate other components of the OXI1 (AGC2-1)signalling pathway, ... mutated to arginine, still interacted with PTI1-4. These data indicate that the kinase activity ofOXI1 is not required for the interaction with PTI1-4.OXI1 interacts with PTI1-4 in vivoBecause various...

Tài liệu Báo cáo khoa học: Degradation of tropoelastin by matrix metalloproteinases – cleavage site speciﬁcities and release of matrikines pptx

... epithelial cells and processes various ECM constituents, such as collagens,gelatin, and laminin, and also non-ECM proteins,including pro-tumor necrosis factor-a and a2-macro-globulin [2]. MMP-9 ... mm; Dionex) and elution using a linear binarygradient: 5–65% ACN in 0.1% formic acid in 35 min,maintenance at 65% ACN for 10 min, and 65–5% ACN in 10 min.The typical operating conditions for ... does not contain a hemopexin-like domain and actsonly with its catalytic domain, and MMP-12 is special in that it autocatalytically loses its hemopexin-like domainsoon after activation without...

Tài liệu Báo cáo khoa học: parDtoxin–antitoxin system of plasmid R1 – basic contributions, biotechnological applications and relationships with closely-related toxin–antitoxin systems ppt

... affecting RNA binding, whereasmutants affecting residues proposed to be involved in speci c RNA binding had a reduced binding activity but maintained a basic, although reduced, RNase activity. In ... of RNase A and RNase T1 and involves a catalytic acid, a catalytic base and a residuestabilizing the reaction intermediate. RNA bindingoccurs on a concatemeric RNA surface containing resi-dues ... Kid toxin interacts with a single RNAsubstrate. This implies that RNA binding to one of thesymmetric binding surfaces introduces structuralchanges in the Kid protein that prevent the binding...

Tài liệu Báo cáo khoa học: The multicopper oxidase from the archaeon Pyrobaculum aerophilum shows nitrous oxide reductase activity docx

... vibrationalmodes in the low-frequency region, originating from thecoupling of the Cu–S(Cys) stretch with the S C b– C a(Cys) bond, as typically observed in copper proteinscontaining a T1 site ... Purification of recombinant McoP produced in Escherichia coli.Fig. S1. SDS ⁄ PAGE analysis of McoP overproduction and purification.Fig. S2. CD spectrum in the far-UV region, reflectingthe typical ... polyhemic c- type cytochromes, butits genome sequence contains two ORFs that code forputative c- type monohemic, cytochrome-containingproteins [15]. Nevertheless, as the substrate specificityof MCOs...

Tài liệu Báo cáo khoa học: Novel aspects of heat shock factors: DNA recognition, chromatin modulation and gene expression ppt

... speciﬁcity mayenable an HSF1–HSF2 heterotrimer to have a distinctHSE speciﬁcity.Binding of HSF to chromatin and changes in chromatin structurePackaging of DNA into nucleosome arrays, which canbe ... unknown[10–12]. In addition, protein protein interactions with HSPs and other proteins can regulate the monomeric–trimeric transition of HSF in cells [2]. Transcriptionactivation domains have been located ... DBD–DBD interaction is important in theHSF–HSF and HSF–HSE interactions. In HSF DBD–HSE co-crystals, the protein protein interface consistsof the helix 2 amino-terminus, the turn and the wing[15]....

Tài liệu Báo cáo khoa học: The miRNA-192 ⁄194 cluster regulates the Period gene family and the circadian clock doc

... sites which were gener-ated using the following primers: GGATGAACCTTCATACCCTTTCCAAGACGAAAACAACAGACAGACCTTTTTAAGTCCTGGACTT, GAGCCCCAAACCTTAGCCTCATTTATTTTGTTCAAAACAATAAGTCATTTTCCCCTTAGAGTGCTTGAAGAA ... using the following primers:GGTAGCAGTCTGCATTCTTATGGCCATTAGAAAAACAAAACTCCTTGCCTCTAAAGTCAGATCATGAA and GCCTCTGCCAGTGTCCCCAGCACTTTTCAAAACTTTGGACACTTGGGGAAAAGTGAGG. Luc-Per3-3¢UTR-Mut contains ... GCGACGTCTTAAACTCCATTCTGGGACCATCTCC; Per1 rev, GCACCGGTGGCGTTTTTATCTTTTTGTATT; Per2 forw, GCGACGTCTTAACAGCCAGCGAGGTACACCAGGTGG; Per2 rev, GCACCGGTGGCAAACAGGTCATAAAAAGACAC; Per3 fo-rw, GCGACGTCTTAAGTGACTGTGAGGATGAACCTTC;...

Xem thêm

Từ khóa: Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ