0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

... GCTTCTGGATCGTAGTTCAA CATTATTGGAATGAGGAAATATH1_G ATTTCCTCATTCCAATAATG TTGAACTACGATCCAGAAGCATH1_3633_BHGGATCCTCATTGAGAACAATTTCCTTGAATH1_395_BHGGATCCATCATGTTCTCATCATCATAATATGATH1_209_BHGGATCCGTTAAATATAATGCAGTGACGAAGATAATH1_140_BHGGATCCAAGTCAAACCTTGAGAAAGAACGAmCherry–pSC1_D ... recombination region in italics.Name Oligo sequenceF2_ATH1 ATGATGATGATAACAAAGGAGCTACAATCAAGGAAATTGTTCTCAATGATCGGATCCCCGGGTTAATTAAR1_ATH1 ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAACATH1_pUG36_D ... ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAACATH1_pUG36_D GCACTAGTATGAAAAGAATAAGATCGCTTTATH1_pUG36_R GCCCCGGGATCATTGAGAACAATTTCCATH1_)1000_BH GCGGATCCGTATGACCACATTCTATACTGAATH1_+508 GAGCCAATATCAAATCTGGTGGTAATCCATH1_A GAGGAACAAAAATAGTACCGGTAATAACATH1_B...
  • 15
  • 475
  • 0
Tài liệu Báo cáo khoa học: Down-regulation of heme oxygenase-2 is associated with the increased expression of heme oxygenase-1 in human cell lines docx

Tài liệu Báo cáo khoa học: Down-regulation of heme oxygenase-2 is associated with the increased expression of heme oxygenase-1 in human cell lines docx

... The intracellular concentration of heme is maintained by the rate of its synthesis and degrada-tion [1]. Many enzymes and their regulators areresponsible for heme synthesis [1,2]. On the otherhand, ... in the accumulation of heme in the hemin-treated HepG2 cells. Taken together with the siHO-2-mediated induction of HO-1 expression, these resultssuggest that HO-2 rather than HO-1 may play the ... human cell lines. HeLa cells (A and B) and HepG2 cells (C and D) were leftuntreated or treated with SA (5 mM) for the indicated time and harvested. The upper panels in (A) and (C) show the northern...
  • 14
  • 487
  • 0
Tài liệu Báo cáo khoa học: An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity pdf

Tài liệu Báo cáo khoa học: An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity pdf

... melanoma cell line, but in contrast to what wasobserved in RAW 264.7 cells, the mutant was able toefficiently kill these cells. These data are consistentwith the notion that induction of pyroptosis ... suggests that different types of cellsare killed by LF as a result of the cleavage of distinctsubstrates.To summarize, we have isolated an LF mutant that is impaired in its ability to activate the ... retains its ability to kill the melanoma cells, as it has been shown previouslythat inhibition of the ERK pathway is sufficient toinduce apoptosis. It is unclear why the mutant is defec-tive at...
  • 9
  • 579
  • 0
Tài liệu Báo cáo khoa học: Accessibility changes within diphtheria toxin T domain when in the functional molten globule state, as determined using hydrogen⁄deuterium exchange measurements pdf

Tài liệu Báo cáo khoa học: Accessibility changes within diphtheria toxin T domain when in the functional molten globule state, as determined using hydrogen⁄deuterium exchange measurements pdf

... In the case of the T domain, the MGstate corresponds to the functional state, which initi-ates the translocation of the catalytic domain. Here, the data allowed identification of the core of the ... structure, TH5 is partly accessible at the surface of the T domain. We propose that its high protection is caused by the formation of dimers. Within the molten globule state, high protection is still ... line). (B)Estimation of the size of the T domain at pH 7.0. At pH 4 this esti-mation is highly approximated because the elution volume of the Tdomain is close to the void volume of the column.Accessibility...
  • 10
  • 530
  • 0
Tài liệu Báo cáo khoa học: Toggle switches, pulses and oscillations are intrinsic properties of the Src activation/deactivation cycle doc

Tài liệu Báo cáo khoa học: Toggle switches, pulses and oscillations are intrinsic properties of the Src activation/deactivation cycle doc

... Ðkfa2kra2Sa2Á S À!kcata2Sa2þ Sa1ð1Þ The autophosphorylation rate (v3) is the sum of the rates catalyzed by each form. Applying quasi steady-state (QSS) approximation for the intermediate com-plexes, ... and the activatory residue is dephosphorylated; S is the partially active form, where both the inhibitory and activatory resi-dues are dephosphorylated; Sa1 is the fully active conformation,where ... If the negative-regulatorytyrosine residue Yi is phosphorylated, whereas the acti-vatory residue Ya is dephosphorylated, Src is catalyti-cally inactive. In this autoinhibited conformation,...
  • 17
  • 512
  • 0
Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: electron transfer through the nitric oxide synthase flavoprotein domain pdf

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of flavoproteins: electron transfer through the nitric oxide synthase flavoprotein domain pdf

... that there is always a Keqposition for maximum electron fluxthrough the enzyme. On either side of this optimum, the electron flux drops off because either the formationrate (k2) or dissociation ... kinetic model for NOS catalysis. Ferric enzymereduction (kr) is rate limiting for the biosynthetic reactions (centrallinear portion). kcat1 and kcat2 are the conversion rates of the FeIIO2species ... difficult to poise in all the intermediate states that are likely to be populatedduring catalysis. For example, this includes the 2- and3-electron reduced state, with accompanying variationsin...
  • 16
  • 639
  • 0
Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt

Tài liệu Báo cáo khoa học: Characterization of human deoxyribonuclease I gene (DNASE1) promoters reveals the utilization of two transcription-starting exons and the involvement of Sp1 in its transcriptional regulation ppt

... induced by ischemia during AMI orPCI remain to be elucidated. Delineation of the molecular basis for our observations is essential toevaluate the elevated DNase I activity in the sera ofpatients ... indi-cated by overbars. The underlines repre-sent the locations of the twooligonucleotide probes used for further ana-lysis. The position and identity of mutations at )11944 to )11941 are indicated ... numbers over the diagrams indicate the position of the corresponding nucleotides relative to the translation start site, and the numbersin parentheses below the diagram show the position of the corresponding...
  • 12
  • 609
  • 0
Tài liệu Báo cáo khoa học: Multiple promoters regulate tissue-specific alternative splicing of the human kallikrein gene, KLK11⁄hippostasin ppt

Tài liệu Báo cáo khoa học: Multiple promoters regulate tissue-specific alternative splicing of the human kallikrein gene, KLK11⁄hippostasin ppt

... to study the tissue-specific use ofeach promoter. We show the translation initiation siteof isoform 2 and different intracellular distribution ofisoforms 1 and 2, and discuss the regulatory mechan-ism ... initi-ation sites.Determining the translation initiation site ofisoform 2 KLK11Messenger RNA for isoform 2 contains two initiationcodons near the 5¢ end. To examine whether the firstinitiation ... for M33S was translated in cell- free wheatgerm lysate, the translational product detected withan antibody raised against KLK11 was the same sizeas that of the translational product by isoform...
  • 9
  • 544
  • 0
Tài liệu Báo cáo khoa học: Altered expression of CD1d molecules and lipid accumulation in the human hepatoma cell line HepG2 after iron loading pptx

Tài liệu Báo cáo khoa học: Altered expression of CD1d molecules and lipid accumulation in the human hepatoma cell line HepG2 after iron loading pptx

... dropletaccumulation, respectively. Phosphatidylserine is alipid that is enriched in the inner face of the plasmamembrane and that is translocated into the outer faceunder certain cellular states. ... with ferric citrate. Rather, theseoxidants induced cell death of HepG2 cells (data notshown).Upregulated CD1d expression and alterationsin lipid parametersConsidering that CD1d is an unconventional ... accu-mulation in the liver of hemochromatosis patients is associated with oxidative stress and increased expres-sion of ICAM-1 [13]. On the other hand, a recentin vitro study examining the effect...
  • 14
  • 682
  • 0
Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx

Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx

... stimulated for 5 min if notindicated otherwise. All experiments were carried out induplicate at least three times, if not otherwise indicated.Western BlottingEqual amounts of cell lysate proteins ... induces the activationand phosphorylation of Ras-GRF1. Furthermore,Ras-GRF1 is also heavily phosphorylated upon agon-ist activation of GPCRs, but the exact role of thesephosphorylations is not ... andimmediately frozen in liquid nitrogen. The thawed cell ly-sates were cleared by centrifugation (13 000 g at 4 °C) and the protein concentrations in the supernatants were quanti-fied by the BC...
  • 13
  • 730
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa họctài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học tài chính côngbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểtai lieu bao cao thuc tap khoa co khitai lieu bao cao thuc tap tai khoa duoc benh vientai lieu bao cao thuc tap y si da khoabáo cáo khoa học ảnh hưởng của việc thay thế cỏ xanh trong khẩu phần bằng bã dứa ủ chua đến khả năng sản xuất của bò thịt potbáo cáo khoa học ảnh hưởng của tuổi thu hoạch đến năng suất và chất lượng thức ăn của cỏ voi pennisetum purpureum cỏ ghi nê panicum maximum trồng tại đan phượng hà tây pptxcac tai lieu ngien cuu khoa hoc cua the gioitai lieu bao cao thuc tap tim hieu nhan cach mot hoc sinhtai lieu bao cao thuc tap nganh the duclam the nao de tom tat bao cáo khoa hocbáo cáo khoa học về nghệ thuật trong lieu trai chi diBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ