Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

... multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes Stan Stasinopoulos1, Mythily Mariasegaram1, Chris Gafforini1, ... CTTTGTTATTTATTATGCATTCCTATGGTGAGTT Forward (nt 15 52 1585 PAI -2) SJS260 AACTCACCATAGGAATGCATAATAAATAACAAAG Reverse (nt 1585–15 52 PAI -2) SJS261 CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT Forward (nt 15 52 1585 ... the PAI -2 mRNA transcript involves an interactionbetween closely spaced adenylate- uridylate elements in a manner analogous to the post-transcriptional regulation of oncogenes and cytokines. AbbreviationsARE,...

Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

... CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGTTCAGCTTGAAAGCPEP4_R TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTTCAAATTGCTTTGGCSGA1_D CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGGCAAGACAAAAGATGTTSGA1_R ... TTTAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTGAATTCGAGCTCGTTTAAACHA_D ATTTCCTCATTCCAATAATG TACCCATACGATGTTCCTGHA_R CAAAGCGATCTTATTCTTTT AGCGTAATCTGGAACGTCATH1_1 ACTACGTATCACGACAAACCAACAGCCGATH1 _2 ... CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGGCAAGACAAAAGATGTTSGA1_R TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTCTACAAACTCTGTAAAACTTATH1_suc2 AACGGCCCTTCGCAAGTGCAGCTGCGGGATGCAGTCTTGATGAATGGGTTGAACTACGATCCAGAAGCATH1_pep4 TTCACTGAAGGTGGTCACGATGTTCCATTGACAAATTACTTGAACGCATTGAACTACGATCCAGAAGCATH1_pLC1...

Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

... literature: the dominant polymorph a- chitin (antiparallel packing of the chitin chains);b-chitin (parallel packing of the chitin chains); and the minor polymorph c-chitin (mixture of parallel and antiparallel ... )2. G. Vaaje-Kolstad et al. L. lactis chitinase and chitin-binding proteinFEBS Journal 27 6 (20 09) 24 02 24 15 ª 20 09 The Authors Journal compilation ª 20 09 FEBS 24 07subsites )2 to +2. Analysis ... chitinolytic system of Lactococcus lactis ssp. lactiscomprises a nonprocessive chitinase and a chitin-bindingprotein that promotes the degradation of a- and b-chitinGustav Vaaje-Kolstad, Anne...

Tài liệu Báo cáo khoa học: The Alzheimer b-peptide shows temperature-dependent transitions between left-handed 31-helix, b-strand and random coil secondary structures doc

... 3B). Ala21 mainly follows the same pattern asAla2 in Ab(1–9). The other residues show a minimum/ angle at 10–15 °C, after which they return towards a random coil average. The two phenylalanines ... similar to residues 2 8, whereas Ala21goes directly from PII-rich state to random coil. Val18,Phe19, Phe20 and Val24 on the other hand seem to start in a b-strand-rich conformation already at ... the 3JHNHacouplings in the twofragments Ab(1–9) and Ab( 12 28 ) (Fig. 3) indicatethat residues 2 8 begin in a PII-rich average conforma-tion at 0 °C, move towards a b-strand conformation at 20 –30 °C, and ﬁnally...

Tài liệu Báo cáo khoa học: "The Structure of User-Adviser Dialogues: Is there Method in their Madness?" pdf

... i) the structure of the task that the user is trying to accomplish and the user's goals and plans arising from the task; 2) the strategies available to the user when the user is unable to ... users' and adviser's plans and goals. BOUNDARY MARKERS The analysis of boundary markers revealed reliable indicators at the opening of subdialogues in adviser-user dialogues. This is ... non-pronominal and pronominal noun phrases. Both analyses are consistent with the derived dialogue structure on the basis of the task structure and the users' and adviser's plans and goals...

Tài liệu Báo cáo khoa học: The undecided serpin The ins and outs of plasminogen activator inhibitor type 2 pdf

... (tissue-type- and urokinase-type plasminogen activator; tPA, uPA) were in turn speciﬁcally inhibitedby plasminogen activator inhibitors (PAIs)-types 1 and 2, both of which belong to the serine protease inhibitor (serpin) ... Hofmann GE, Glatstein I, Schatz F, Heller D & Delig-disch L (1994) Immunohistochemical localization ofurokinase-type plasminogen activator and the plasmino-gen activator inhibitors 1 and 2 ... 4007–4 024 . 27 Sharon R, Abramovitz R & Miskin R (20 02) Plasmino-gen mRNA induction in the mouse brain after kainateexcitation: codistribution with plasminogen activator inhibitor- 2 (PAI -2) ...

Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efﬁciency doc

... InsP6gradually into InsP5, InsP4, and the ﬁnal product – Ins (2, 4,6)P3 and Ins(1,3,5)P3– via two alternative pathways [14].Bacterial BPPs containing two tandemly repeateddomains (dual domains) ... they can increase the amount of available phosphate by interacting together. Additionally,fusing PhyH-DI to a single-domain phytase appears to be an efﬁcient way to improve the activity of the ... Trans1-T1 (TransGen, Beijing, China) and pGEM-TEasy (Promega, Madison, WI, USA) were used for genecloning and sequencing, respectively. E. coli BL21 (DE3)(TaKaRa, Ostu, Japan) and pET -22 b(+)...

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

... 1 425 .39 Matsuoka D, Nanmori T, Sato K, Fukami Y, KikkawaU & Yasuda T (20 02) Activation of AtMEK1, an Ara-bidopsis mitogen-activated protein kinase kinase, in vitro and in vivo: analysis of active ... or HIS-PTI1-4 (PTI) in kinase buffer and [c- 32 P]-ATP. For (A) and (B) the top panel shows the kinaseassay visualized by autoradiography and the bottom panel shows the Coomassie Brilliant Blue-stained ... a negative control. The top panel shows the kinase assayvisualized by autoradiography and the bottom panel shows the Coo-massie Brillian Blue-stained SDS ⁄ PAGE. The in vitro kinase assayswere...

Tài liệu Báo cáo khoa học: The central role of CDE/CHR promoter elements in the regulation of cell cycle-dependent gene transcription pdf

... Caenor-habditis elegans synMuvB proteins and is composed ofp130, E2F4 ⁄ 5 and DP1 ⁄ 2 and a module containing the MuvB proteins Lin-37, Lin- 52, Lin-54 and chromatin-associated Lin-9 and Lin-53 ... CDE acts as an activating element binding E2F1, -2 and -3. These acti-vating E2Fs cooperate with NF-Y proteins binding to CCAAT-boxes and with Myb proteins associating with a distal Myb site in ... notknown [28 ,29 ]. By contrast, cyclin B1 and cyclin B2are central to the regulation of progress through the cell cycle (Fig. 1). Cyclins B1 and B2 appear in S phase and accumulate in G 2 and mitosis...

Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt

... reagents and the recombinant humanTRAIL ⁄ APO 2 ligand were purchased from Invitrogen and Feldan Bio (St-Laurent, QC, Canada), respectively. The caspase 3 substrate (Ac-DEVD-pNA) and the inhibitor substrate ... 1 329 membrane to induce apoptosis. J Biol Chem 27 7, 122 37– 122 45. 24 Azakir BA & Angers A (20 09) Reciprocal regulation of the ubiquitin ligase Itch and the epidermal growth fac-tor receptor signaling. ... supported by the Natural Sciences and Engineering Research Council of Canada DiscoveryGrant 28 823 8 to AA. AA is supported by a FQRNTyoung investigator award. We thank D. Du Pasquierfor the kind gift...

Xem thêm

Từ khóa: báo cáo khoa học tài liệu báo cáo tài liệu báo cáo nghiên cứu khoa học tài liệu về báo cáo khoa học báo cáo khoa học tài chính công Báo cáo quy trình mua hàng CT CP Công Nghệ NPV Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Chuong 2 nhận dạng rui ro BT Tieng anh 6 UNIT 2 Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP