Tài liệu Báo cáo " A new natural source of Camphor from Cinnamomum longepetiolatum Costerm apud Phamh in Vietnam " doc
Tài liệu Báo cáo " A new natural source of Camphor from Cinnamomum longepetiolatum Costerm. apud Phamh. in Vietnam " doc
... shows that Cinnamomum longepetiolatum Costerm. apud Phamh. was a new natural source of camphor in Vietnam. Keywords: Cinnamomum longepetiolatum, Lauraceae, Essential oil, camphor. 1. Introduction∗∗∗∗ ... Journal of Science, Natural Sciences and Technology 24 (2008) 211-213 211 A new natural source of Camphor from Cinnamomum longepetiolatum Costerm. apud Phamh. in Vietnam Tran Dinh Thang ... found in Vietnam. As a part of the research on the essential oils of Medicinal and Aromatic plants of the Vietnam flora, especially in the course of systematic study of Lauraceae in Vietnam, ...
- 4
- 403
- 0
Tài liệu Báo cáo khoa học: Quantitative estimation of channeling from early glycolytic intermediates to CO2 in intact Escherichia coli pdf
... [14C]aminoacyl-tRNA (made in the pathway from 14C-labeled amino acids), [3H]aminoacyl-tRNA,14C- and3H-labeled protein were measured. The3Hinprotein was insignificant, showing that the aminoacyl-tRNA ... channeling of aminoacyl-tRNA for protein synthesis. The cells wereelectroporated to facilitate entry of 3H-labeled amino-acyl-tRNA and14C-labeled free amino acids. The quan-tities of [14C]aminoacyl-tRNA ... aminoacyl-tRNA made from amino acids and tRNA did not mixwith the introduced aminoacyl-tRNA; i.e. there wasperfect channeling from free amino acids to protein. In this experiment, it was not...
- 10
- 438
- 0
Tài liệu Báo cáo khoa học: Transient silencing of Plasmodium falciparum bifunctional glucose-6-phosphate dehydrogenase) 6-phosphogluconolactonase docx
... (X74988) GAACTCCAGGAAAAACAAGTCAAG TTTTGACAAGTCCAAATACCTCTTT CGGCCAACGTTAAAAAGTATCGGATGGAATTTTGGCCGPfGPx (PFL0595C) AATTGTGATTCGATGCATGATG TTTATCGACGAGAAATTTTCCAA CGGCCAACGTTAAAAAGTATCGGATGGAATTTTGGCCGTransient ... (AL929357) TTGTACTAATATTCCTTCAATATTTGCTG GCCACGGGCGCTAATT CCGGGCTGTAGGAGACGTAGCTGAAAATGTCCCGGPfSOD (PF08–0071) CAACGCTGCTCAAATATGGA CATGAGGCTCACCACCACA CGCGCCTACTTTTTACTGGGATTCTATGGGACCTGGCGCGPfG6PD-6PGL ... (5¢-to3¢)Pf18srRNA (M19172) TGACTACGTCCCTGCCCTT ACAATTCATCATATCTTTCAATCGG GGGGGACACCGCCCGTCGCTCCCCCPfGR (NC_004317) AGTGGAGGAATGGCTGCAG CCTAAACGGGATTTTTCGACA CGGGCAGCAAGGCATAACGCAAGCCCGPfTrxR (AL929357)...
- 10
- 437
- 0
Tài liệu Báo cáo khoa học: Subproteomics analysis of Ca2+-binding proteins demonstrates decreased calsequestrin expression in dystrophic mouse skeletal muscle pdf
... steel tray.The tray was then placed on top of a hot plate and thetemperature maintained at 9 0 °C for 5 min to aid thestaining of protein spots. The tray was then placed on a laboratory shaker ... (Molecular D ynamics) withIMAGEQUANTV3.0 software.Results In order to determine the fate of the terminal cisternaeCa2+-binding protein, calsequestrin, and related luminalsarcoplasmic reticulum ... gels.2D ‘Stains-All’ analysis of dystrophic muscleThe cationic carbocyanine dye ÔStains-AllÕ was u sed todetermine potential changes in the expression of majorCa2+-binding proteins in dystrophic...
- 10
- 588
- 0
Tài liệu Báo cáo khoa học: "Structural Definition of Affixes from Multisyllable Words" docx
... c/t as in lac/tate m/b as in am/bition r/t as in fer/tile m/p as in am/pere p/t as in ap/titude r/l as in pur/loin r/b as in ar/bor n/d as in ban/dit and so on. Therefore, more difficulty in ... eliminate them at this point in the research. What is indicated, perhaps, is the structural classification of the weak suffixes by degree of weakness as a means of approaching the suffix -in- ... be blank in either case. The criterion of four or more words in establishing an affix probability and of two or more consonant strings in defining an affix from a prob- ability was established...
- 4
- 508
- 0
Tài liệu Báo cáo khoa học: Functional dissection of the Schizosaccharomyces pombe Holliday junction resolvase Ydc2: in vivo role in mitochondrial DNA maintenance pptx
... region of Ydc2 (residues 1–35)contains a small putative DNA-binding SAP motif (afterSAF -A/ B, Acinus and PIAS) associated with proteinsinvolved in chromosomal organization and DNA repair [27]. In ... role of recombination in mtDNA inheritance in S. cerevisiae showed that buddingcells were enriched in linear monomers of mtDNA. It wasproposed that in addition to a role in initiating a rolling-circle ... intermediate is thereforecrucial for the integrity and maintenance of DNA in allorganisms including mitochondrial DNA (mtDNA).Mitochondrial DNA amounts to about 15% of the DNAcontent in Saccharomyces...
- 11
- 575
- 0
Tài liệu Báo cáo khoa học: Regulatory modes of rod outer segment membrane guanylate cyclase differ in catalytic efficiency and Ca2+-sensitivity ppt
... Analysis of data wasperformed withORIGIN6.1 andSIGMA PLOT4.2 software. A direct plot of activity vs. [GTP] gave in all cases a sigmoidalcurve indicating cooperative substrate binding. In order ... Biochemical analysis of a dimerization domain mutation in RetGC-1 associated withdominant cone-rod dystrophy. Proc. Natl Acad. Sci. USA 96,9039–9044.16. Duda, T., Venkataraman, V., Jankowska, A. , ... toanalyze data of a sigmoidal dependence in a linearLineweaver–Burk plot [41], we determined a Hill coefficientn from a fit of the direct plot. Values of Vmaxand Kmwerethen determined from...
- 8
- 505
- 0
Tài liệu Báo cáo Y học: Structural determinants of the half-life and cleavage site preference in the autolytic inactivation of chymotrypsin pdf
... (Millipore).Determination of the autolytic inactivation ratesThe active enzymes were incubated in the assay buffer at37 8C at a 1.0 mM initial concentration. For determiningTable 2. Rate constants of autolytic ... fragments Iand IV and the appearance of fragment II in the degradation of the Tyr146!His/Asn147!Ser mutant (panel d)indicated a significant decrease in the rate of cleavage of the autolysis loop. At ... atomicsurfaces that are in van der Waals interaction.) For finding hydrogenbonding and van der Waals interactions, data were taken from chymotrypsin(ogen) structures under the following protein data bankaccession...
- 9
- 613
- 0
Tài liệu Báo cáo khoa học: Solution structure of hirsutellin A – new insights into the active site and interacting interfaces of ribotoxins docx
... length of the N-terminal hairpin in HtA isintermediate between those in RNse T1 and a- sarcin,having 20 amino acids in HtA, 26 in a- sarcin and 12 in RNase T1. From a functional point of view, ... in HtA replaces a tyrosine of a- sarcin, and the aromaticring of F126, close to the catalytic H113, replaces a leucine side chain in a- sarcin in a similar arrangementto that found in RNase T1. ... should favor a salt bridge interaction that will decrease the pK a of theaspartic acid and increase the pK a of the histidine sidechain groups. Finally, E66 and R95 are in their canon-ical positions...
- 10
- 607
- 0
Tài liệu Báo cáo khoa học: Crystal structure of the catalytic domain of DESC1, a new member of the type II transmembrane serine proteinase family pptx
... rigiddomain association for the N-terminal SEA domain with the back site of the proteinase domain.AbbreviationsHAI, hepatocyte growth factor activator inhibitor; HAT, human airway trypsin; PAI-1, ... analysis of DESC1 suggests a possible rigiddomain association between the N-terminal SEAdomain and the back site of the proteinase domain.This interaction would fix the SEA domain in a loca-tion ... tobe an artifact of the missing N-terminal domainbecause in DESC1, as well as in matriptase, the con-formation of this residue is stabilized by a salt bridge of the C-terminal carboxylate group...
- 13
- 588
- 0
Từ khóa: tài liệu báo cáo môn triếttài liệu báo cáo tài chínhtài liệu báo cáo môntài liệu báo cáo khoa họctài liệu báo cáo nghiên cứu khoa họctài liệu báo cáo tài chính vốn bằng tiền tai doanh nghiệpBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ